MonsterPlex is a pre-sequencing technology provided as a service.

The user provides DNA (or cDNA) and a multi-FASTA file with the target SNP or region bracketed with 60-100bp up and downstream of the target SNP. For gene profiling, provide up to 400bp of each exon to be amplified (SNP examples follow).

>MyTarget#1

…ATCGATCGATCGATCGATCGATCGATCG[N]ATCGATCGATCGATCGATCGATCGATCG…

>MyTarget#2

…AAGGCCTTCGATTC[N]GGCTAAGGCGTAACTAGGAA…

 

Floodlight Genomics does the following:

1. Designs and orders custom primers. These are yours but Floodlight Genomics keeps them and only uses them with your permission. There is generally sufficient primers for >100,000 assays. You can publish the primer sequences or keep them private.
2. Determines optimal primer mixtures and amplifies the organism-specific targets from client DNA (or cDNA for gene profiling applications).
3. Constructs a sequencing library using the pooled and barcoded amplicons.
4. Sequences the library and delivers sample-specific FASTQ files. 
5. Data analyses (mapping and genotype calls) are available upon request for an additional fee.

As many as 10-20% of an initial multiplex will fail and new primers can be added at any time.

The cost per target depends on the number of DNA samples to be tested and takes into account the following factors:

1. The number of targets (= number of primer pairs). The client pays up front for organism-specific primers. Once purchased, primers are generally good for >100K assays. Although the primers are not made directly available to the client, they will not be used for additional projects without the clients consent.
2. The number of DNA samples to be processed.
3. The sequencing device employed.

All pre-sequencing library work is accomplished at our research facility in Knoxville TN on the University of Tennessee campus. Sequencing is accomplished at various sequencing centers.

The MonsterPlex technology was developed in response to the huge amounts of unused whole genome sequence (WGS), genotype by sequencing (GBS) and restriction-site associated DNA (RAD) data produced in our research program. Primarily interested in a subset of the variation in any one genome, our first attempt to “farm out” targeted sequencing to a vendor was a bit shocking. For 1000 samples and 100 targets, the total cost was quoted at over $200,000.

If there is a less expensive way to do custom targeted sequencing with over 1000 samples and >100 targets – we’d love to know and will send you a $20 gift card in thanks for the info (you pick the vendor). We don’t want to waste anybody’s time or money.